Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E294459

Search information 
Request: 294459Match: SGN-E294459
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81058Clone name: cLET-14-F12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81058 [cLET-14-F12] Trace: SGN-T106301 EST: SGN-E294458 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294459Length: 506 bp (857 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E294459 [] (trimmed) TTTTTTGTACATCTTTTAATTACCAAAAAAAAAGAGGAAGAAGATATGGCTTGTAATACATTGATGAGTTGTGGAATTCCAGCTGTTTGCCCCTC
TTTCCTCTCTTCTACCAAGTCCAAATTCGCCGCCACGATGCCGGTGTCCGTTGGAGCTACCAACTCCATGTCTCGGTTCTCCATGTCAGCTGATT
GGATGCCCGGGCAGCCCCGTCCATCTTACCTCGACGGCTCAGCCCCCGGAGATTTTGGATTTGATCCACTTGGTTTAGGAGAAGTACCTGCAAAT
TTGGAAAGATACAAAGAATCTGAACTTATTCATTGCAGATGGGCTATGCTTGCTGTTCCCGGAATCATAGTACCAGAGGCATTGGGCTTAGGTAA
TTGGGTCAAGGCCCAAGAATGGGCAGCCATTCCTGGTGGACAAGCTACATATTTGGGCCAGCCTGTTCCATGGGGAACACTTCCTACTATTTTGG
CTATTGAATTTCTAGCCATAGCTTTTGTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294459] SGN-U580126 Tomato 200607 Build 2 162 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106302 [Download] [View] Facility Assigned ID: TMECD30TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5