Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E294518

Search information 
Request: 294518Match: SGN-E294518
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82861Clone name: cLET-22-A6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181928 is on microarray TOM1: SGN-S1-1-3.4.10.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294518Length: 476 bp (913 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E294518 [] (trimmed) TTACATTACAACTAAAAGAAAATGGAGTCAAAGTTTGCTCACATTATTGTTTTCTTTCTTCTTGCAACTTCCTTTGAAACTCTCATGGCACGAAA
AGAAATTGATAGACTAGAAGTCACAGAACTTCTAAAGGAATTTGAATCCGACTTGATGTGCAAAGGAAAATTAAGTTGGCCAGAACTTATTGGTG
TACCAGCACAATATGCTAAGGGAATAATTCAGAAGGAAAATCCATTCGTAACTGATGTTCAAATAGTATTGAATGGTTCTCCAGTCACAGCTGAT
TTTAAGTGTTTTCGAGTTCGTATTGTTGTAAACATTTTAAATGTTGCTGTATCAATTCCAGTGGTTGGTTAATTAATGAATTATTATTGAAGTGA
TTAAGCAGCCACATGTCAAAAAATAATAAGTAGGGTTCATGTTTGATCATTATAATGTCTCCATGTACTCTTACTATACGTAATGGAATAAATTA
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294518] SGN-U578980 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107904 [Download] [View] Facility Assigned ID: TMEDH03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0125 Quality Trim Threshold: 12.5