Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E294706

Search information 
Request: 294706Match: SGN-E294706
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81555Clone name: cLET-17-C19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81555 [cLET-17-C19] Trace: SGN-T106762 EST: SGN-E294707 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294706Length: 486 bp (855 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294706 [] (trimmed) CAAACTTTTTTTTGTACATCTTTTAATTACCAAAAAAAAAAGAGGAAGAAGATATGGCTTCTAATACATTGATGAGTTGTGGAATTCCAGCTGTT
TGCCCCTCTTTCCTCTCTTCTACCAAGTCCAAATTCGCCGCCGCGATGCCGGTGTCCGTTGGAGCTACCAACTCCATGTCTCGGTTCTCCACGTC
AGCTGATTGGATGCCCGGGCAGCCCCGTCCATCTTACCTCGACGGCTCAGCCCCCGGAGATTTTGGATTTGATCCACTTGGTTTAGGAGAAGTAC
CTGCAAATTTGGAAAGATACAAAGAATCTGAACTTATTCATTGCAGATGGGCTATGCTTGCTGTTCCCGGAATCATAGTACCAGAGGCATTGGGC
TTAGGTAATTGGGTCAAGGCCCAAGAATGGGCAGCCATTCCTGGTGGACAAGCTACATATTTGGGCCAGCCTGTTCCATGGGGAACACTTCCTAC
TATTTTGGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294706] SGN-U580126 Tomato 200607 Build 2 162 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106761 [Download] [View] Facility Assigned ID: TMECM22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0110 Quality Trim Threshold: 14.5