EST details — SGN-E294734

Search information 
Request: 294734Match: SGN-E294734
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81674Clone name: cLET-17-K11
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81674 [cLET-17-K11] Trace: SGN-T106790 EST: SGN-E294735 Direction: 3' Facility: TIGR
Clone: SGN-C190919 [TUS-61-K13] Trace: SGN-T349362 EST: SGN-E548487 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294734Length: 367 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294734 [] (trimmed) GTAATGTCTAGCTCAACACAATTTTCTCCAGTTATTCAACAGTTATTCGCAAGAAAATCGAACCCATCGTCCATTTCAGCTTTTAAAGCTTCAAA
ATTGGTACTTTTAGTACCAATTTCCCTAAATTGTTCAAGAATTCACTTGGATTTTAAGGTGAGAGTTCAGGTTTTGGAAAATCATGATGGAGAAA
GTTCTGTACAAGATCTTGATGATTCACCTGCTTCGATTGAGCTACAACACATTTCTGATGAACCCCAATTTGATCGAGTTATAGCTGAAGCACAA
CAGCTTGATGAATCTATTGTGATTCTATGGATGGCAAACTGGTGCCGCAAATGCATATACTTGAAACCAAAATTGGAAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294734] SGN-U575364 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106789 [Download] [View] Facility Assigned ID: TMECM66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0006 Quality Trim Threshold: 14.5