EST details — SGN-E294872

Search information 
Request: 294872Match: SGN-E294872
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81591Clone name: cLET-17-E9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81591 [cLET-17-E9] Trace: SGN-T106926 EST: SGN-E294871 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294872Length: 449 bp (849 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E294872 [] (trimmed) GGGAAGGGCTTGCATTTGGCAACAATGGTTCCCTAGCTGCTGCAACATCTTCTCATGGGCCGGGGAGCAGTTTAGGACCCACACCGAGTAGAATC
TACAGTTTTAAATCAGCATCCAACCGTGAACCCTCTCCATTGGTTGGCAACAGTGGTTTCAGTCAAAAAGCTCCAGATTTGCCCCGAAGTTACAG
TTTCAAATCGGGATCTAACTGTGAACCGTCTTCATCGGCTGGCAACAGTGGCTTCAGTCGAAAAGGTCCAGATTTGCCCACAAATATGCATGTAT
CAGATGATGATATTCTTACCCCTGAGATGGTTCAGGAATTTGCTGAAAATGGTTTTCTTAGCAGTGATCTTGACAACAATATGAGTTATCCTGGA
TGGAAGGGTTGAGTTGCTCCGTGGGGTGGGTGGGTTTTTATGAGAGATAAAAGTACTGCTAATATACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294872] SGN-U575406 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106927 [Download] [View] Facility Assigned ID: TMECM29TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0061 Quality Trim Threshold: 12.5