EST details — SGN-E295129

Search information 
Request: 295129Match: SGN-E295129
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82587Clone name: cLET-20-I20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295129Length: 447 bp (945 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295129 [] (trimmed) GATAACAAGCTATCAGGACCTTTCCCAAGAGAACTTACTAGCATTTCTAGCCTGAAAGTTGTGGATGTCTCGAATAATGATTTGTGTGGAACAAT
TCCTACTTCTGGTCCATTTGAGCATATTCCTCTAAACAATTTCGAGCACAATCCTCGACTTGAAGGTCCGGAGTTGTTGGGACTCGCTACCTACG
ACACCAACTGCTCTTAGAAGCTTGATGAATAGCTTCAGAAGAAGCGCCACTTTAGTGGACGTTTAACAAATTCCCCTGAACCTTGTTTATTGGTG
TACTTACAGTGTGTCCAAAGTTGTAACTCTAAGCAAAAATATGGTGTATGTAGGTTATTACTGAGTTAAGGTATGTGTGTAAAACAATCTCTATA
CTGCTACCAACTGTTGATGTATTTCATATTTTAATGTCTAGTGAAATGGTTCAGTGGGATTAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295129] SGN-U583216 Tomato 200607 Build 2 165 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107543 [Download] [View] Facility Assigned ID: TMECZ58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0037 Quality Trim Threshold: 12.5