EST details — SGN-E295495

Search information 
Request: 295495Match: SGN-E295495
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83155Clone name: cLET-23-I24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191009 [TUS-61-O7] Trace: SGN-T342088 EST: SGN-E541213 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191009 [TUS-61-O7] Trace: SGN-T342091 EST: SGN-E541216 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295495Length: 504 bp (954 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295495 [] (trimmed) CGAGTGCGAGCTGTGCTACTCCTTACTCCAAATCTCCGTCTTCTCTCTCACGCTCTTTGTCTCTGCAATACCGCGAGCTCTGTAACTTGCCATAC
AAGTGTAAGCAGCACCAGAATGTTCGAATCGGTCTCTCGGTTGAGAACGATAAGGGCTTTGGAACATGGAAAACCTCTTCTCCTTCGTCTCTGCG
TGTTTTCTGTATCCGCGATACCCAAGCTGCAGCTGTCACTGCTAAGTCATGGGATAAATTGATATTAGGCAGTGATACTCCTGTTCTTGTTGAAT
TTCATGCCACTTGGTGTGGCCCCTGCCAGATGGTTCACCGGGTAATTGATGAGATTGCAGGTGAGTATTCAGGGAGACTTAAATGCTATGTACTG
GACGCAGATCGTGAACCAAAAGTTGCTGAGAACTATGATATCAAGGCTGTCCCTGTGGTGTTACTGTTCAAGAATGGGGAGAAATTTGAGTCCGT
TATCGGAACAATGTCCAAGGAGTTCTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295495] SGN-U564796 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108220 [Download] [View] Facility Assigned ID: TMEDL60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5