EST details — SGN-E295629

Search information 
Request: 295629Match: SGN-E295629
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83708Clone name: cLET-25-M23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191060 [TUS-62-A10] Trace: SGN-T342178 EST: SGN-E541303 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295629Length: 423 bp (879 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295629 [] (trimmed) AAGTTGAAATTTTTACTTTCGATTTTGCCGGTATGTCCATGTTCTAACTTTCACATCAAATATGGGAATGTCATGAAAGCTGTACAAGCCATGTC
AAACTAACTCTACTGTCTTCACATTCTTGTGCATTGATCTAATGACTGTTGTAACTTGTTCAATCTGATCTTCACTTGAACAAGACGAAAGGAGC
ACTTTGGCTGTTCCGCCATCTGGATAGCAACCTTCATCGATCATTTCCTCGAAGATTTCTAAGCATCTTTGGTACTGTTTCTTTTTGGAGTATGC
TCCAAGACGGGAAGTCCATGTAACCACATCTGGCTGCAGGTTCTTAGAAGGAAGTGATTGGAAAACTTCTTCCATTTTTACGATAAATCCTGAAC
GTCCATATGCATTGATCAAGATATTGTAGGTGCTGATATCGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295629] SGN-U584496 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108354 [Download] [View] Facility Assigned ID: TMEDS84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5