EST details — SGN-E296040

Search information 
Request: 296040Match: SGN-E296040
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84136Clone name: cLET-27-J7
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296040Length: 374 bp (710 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E296040 [] (trimmed) TTGGATGCTAATAGGATTCCACTCTGCTCATGAGGAAGTTTCCCAGAATTTCGTCTTGACTATGCTGTTACTGTATGGTCAATGTGGACTGGACT
GGACATGGAAATTATTAGTGAATGCAGCACAACTTTTGAGAAGTACTTGATGAATGTGTCTCAAAATGTCATTTCAACTTTTTCATACAATTAAG
AAATGTATGAAATCATATGATAACAATTTTCTGTTTTCTATGTAGTTCGTGTTCTATATGTATGTAATTATATTGATATCTGGTTAAAAGGACAG
GTAGATCTAATAGAAAACAAATCTAACAGTGTGTGATATAATAATCAATGAGAAGGAGAACCATGACTGGTTAAATATAATAACTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296040] SGN-U568053 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109247 [Download] [View] Facility Assigned ID: TMEEC52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0095 Quality Trim Threshold: 14.5