EST details — SGN-E296148

Search information 
Request: 296148Match: SGN-E296148
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83320Clone name: cLET-24-D12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191024 [TUS-61-O22] Trace: SGN-T342114 EST: SGN-E541239 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191024 [TUS-61-O22] Trace: SGN-T342117 EST: SGN-E541242 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296148Length: 478 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E296148 [] (trimmed) CAAAATTTTAGTATTTTCTTCTTATCCACATTCAATAATATTCACAAAAAATGAAACTACACAAATTCACCTAAAAATTGAAATCAACAACAAAA
AAAAATCAAATCTTGAAAACCCCCTTTTAGATAGAAGAGCAAAAAAATCAAATCTTGATTTGCCCCTTTTTGAGTTATTGTTGTTTCTAGATAAA
AGAGCAAAAAAAATCAAATCTTGAAAACCCCTTTTCTGTTCTAATGGGTAAAGGAGGCAGTGATGAAAATATGGCTGCTTGGCTTCTTGGTGTTA
ACACCCTCAAGATTCAGCCTTTCAATCTCCCTGCTTTGGGACCCCATGATGTTAGAGTTAGGATGAAGGCTGTCGGTATTTGTGGAAGTGATGTT
CATTACCTCAAGACCATGAGGTGTGCGGATTTTGTGGGTAAAGAACCAATGGTGATTGGGCATGAATGTGCCGGGATCATAGATGAAGTTGGCGG
TGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296148] SGN-U579974 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108665 [Download] [View] Facility Assigned ID: TMEDR18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5