EST details — SGN-E296357

Search information 
Request: 296357Match: SGN-E296357
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81927Clone name: cLET-19-A12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81927 [cLET-19-A12] Trace: SGN-T107447 EST: SGN-E296497 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296357Length: 384 bp (859 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E296357 [] (trimmed) GGGATGCAGAGCGATAGCCCTCACAGTTTTGCGGTGACTCGCTGTGTCCCTGGTCCATCGTGTGCTGATGTGCTGCGGGCTATGCAGTTTGAGCC
TGAACTGATGTTCGAGACTCTCAAGCGCCGTGCATAGGAATTCTTGGAACAAGGATAAGGAGAAGGCTAAGGTGTTGCCTTTGGATCTTTGACCA
ATATGTTATCTCATTTCTTCCACAACATGCCTTACCTTTCGTCTTGCTGGTTAACTGCACAAGCCACTGACAATGCCAATGCCAATACCAATAAT
GGTGGCTATTACTATTACAGTGAAGACAATGCTGCTGCAGAGGAAGATGAGATTTGGTCCTACTAAACTCTGATTGAAGTGTCTCTTGTTAGCAT
CTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296357] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107307 [Download] [View] Facility Assigned ID: TMECV06TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0335 Quality Trim Threshold: 12.5