Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E296525

Search information 
Request: 296525Match: SGN-E296525
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82016Clone name: cLET-19-H19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82016 [cLET-19-H19] Trace: SGN-T107334 EST: SGN-E296384 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296525Length: 650 bp (852 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E296525 [] (trimmed) GATAAGCACTTGGTTTTCAGCAATGGCTTCTTCAGTAATGTCCTCAGCAGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCAC
CCTTCACTGGACTCAAGTCCACCGCTTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGT
TGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGA
GTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACG
ATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTAC
CCACAGGCATGGGTCCGTATCATCGGATTCGACAATGTTCGTCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCT
AGAAAAACTAATTGCCCTATGTTTATAGGGACAGTTTGTTTGAATTCTCCTTTGGGTTTTCCCTTGAGAAATTGAATTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296525] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107475 [Download] [View] Facility Assigned ID: TMECW46TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5