EST details — SGN-E296529

Search information 
Request: 296529Match: SGN-E296529
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82042Clone name: cLET-19-J17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82042 [cLET-19-J17] Trace: SGN-T107337 EST: SGN-E296387 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296529Length: 663 bp (847 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E296529 [] (trimmed) GATTTGTATTGTGATAAAGAGTAGGTGGAGGAAAGAACACAGATAGAGAAAGATTTTGAGCAAATAAAAGAACAAGTTGAGGGAGTTGCTGAGAA
GGGCGAATTGGGTTTGGAAGAATGAGTGCTTCTAGGTTTATAAAGTGTGTTACCGTGGGCGATGGAGCTGTGGGTAAAACTTGTCTTCTCATTTC
GTATACCAGCAACACTTTTCCCACTGATTATGTCCCAACTGTATTTGACAATTTTAGTGCAAATGTGGTTGTCGATGGGAGCACTGTTAATCTGG
GGCTCTGGGATACTGCAGGTCAGGAGGATTACAATAGATTAAGACCTTTGAGCTATCGTGGGGCTGATGTATTTATACTGGCATTTTCTCTCATT
AGCAAGGCGAGCTATGAAAATGTCTCCAAAAAGTGGATTCCTGAATTGAGGCATTATGCTCCTGGAGTTCCAATTATTCTTGTTGGAACAAAGCT
AGATCTCCGAGAGGATAAGCAATTCTTTGTGGACCATCCAGGTGCTGTTCCACTTAGCACTGCTCAGGGTGAGGAGCTGAGAAAGTCGATTGGTG
CTGCTGCTTACATTGAATGTAGTGCAAAAACTCAACAGAACATTAAGGCTGTTTTTGATGCGGCCATTAAGGTGGTCCTACAACCACCCAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296529] SGN-U578524 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107479 [Download] [View] Facility Assigned ID: TMECW57TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5