EST details — SGN-E296863

Search information 
Request: 296863Match: SGN-E296863
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83928Clone name: cLET-26-L10
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182064 is on microarray TOM1: SGN-S1-1-3.2.10.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182064 [TUS-38-J14] Trace: SGN-T187789 EST: SGN-E374519 Direction: 3' Facility: INRA
Clone: SGN-C182064 [TUS-38-J14] Trace: SGN-T187790 EST: SGN-E374520 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296863Length: 375 bp (939 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E296863 [] (trimmed) GGGCAAAGAAGGCATGGTGTGTAACTCAACGAAGTATTCATCTAAGTGAGCGAAAAAATGGCTTCTCTAACACAGCAATTCGTTGGGTTGAAGTG
CCCTCCAATGTCGACAACAAGGCTTGTGAATCCGAGTAATTATCATCACCATCAGAGTAAGCAGAAGCCAAGAATTGTAATACAAGCTGCAGCAG
TAATCGCAAATGCACAAACAAGAGAAAGACTAAAACTTAAAGAGATGTTTGAGGATGCCTATGAGAGATGCCGCACTACACCTATGGAAGGTGTT
GCCTTTACTGTTGATGATTNTCACTCTGCCCTTGAAAAATATGATTTTGACTCCGAAGTTGGTACTAAGGTCAAAGGAACGGTTTTTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296863] SGN-U581075 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108915 [Download] [View] Facility Assigned ID: TMEDZ65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5