EST details — SGN-E296972

Search information 
Request: 296972Match: SGN-E296972
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83810Clone name: cLET-26-D22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191072 [TUS-62-A22] Trace: SGN-T342196 EST: SGN-E541321 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191072 [TUS-62-A22] Trace: SGN-T342199 EST: SGN-E541324 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296972Length: 373 bp (939 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E296972 [] (trimmed) AAAAAAGAACTTGGATAATACTCCTACTTGTAAAATCCCATAGTCTTCACATAAAATCATTTAGAAGAGCTTAATTTGATGGGAATTTAAAAGGG
TTGTCTTGAAATACTTCAATTTTTTCTAATCTTGGAAAACTGTATTAAGCTCAAAGGTGACATTTTTATCTTGTCATAAGCAAGAAAGTTCAAAA
TGTTGCCTAAAGAACCATCATTTTGTATATATAATACTGAAGATGGGGTTGATGAGATGAAGGAAAATCAAGATTTGGTTAGGTCTGTGACAATA
GGGGATATTGTATCAGATATAGGTAGTAGTGATTTCAGTTTTGGGAAAAAGGGGATGGGGTTGATTGAAGAAGATGAGAATGAAGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296972] SGN-U573050 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109024 [Download] [View] Facility Assigned ID: TMEDZ23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5