EST details — SGN-E297233

Search information 
Request: 297233Match: SGN-E297233
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84495Clone name: cLET-29-A19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182114 is on microarray TOM1: SGN-S1-1-1.4.10.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182114 [TUS-38-L16] Trace: SGN-T187797 EST: SGN-E374527 Direction: 3' Facility: INRA
Clone: SGN-C182114 [TUS-38-L16] Trace: SGN-T187798 EST: SGN-E374528 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297233Length: 634 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E297233 [] (trimmed) GTGAAAATGGGCTACTCCAGGGTTCTTATTGTTAGTAGTCTACTTCTAGTGTTTCAATTATCAACTGTAGTGGCGAAAGGCAAAGCGATTGGATC
TCCAATCATGGCACCAGCACCAGCACCAGGTCCTGAATACACAAACCTAACGGACTTACTCTCCGTTGCAGGGCCTTTTCATACATTCCTTAACT
ACCTTGTATCGACTAAAGTCATCGAGACTTTCCAAGCCCAAGCTAACAATACAGAAGAAGGGATCACACTTTTTGTTCCTAAAGACTCAGCCTTT
ACCTCACTGAAAAAGCCCTCACTTTCCAATCTTACCTCAGAACAACTTAAGTCCCTTTGCCTTTTCCACGCATTGCCACATTACTATAGTCTAGC
TGATTTCAAGAACCTTAGTGATGTTAGCCCTATTAATACCTTGGCTGGAGGGAACTTATACTCTTTGAACTTCACCGATGACTCTGGGACCGTTC
ATCTTAACTCAGGATGGTCTAGGACTAAAGTTAGCAGCGCTGTTCGCACCACTTATCCAGTTGCTGTTTATCAGGTGGACAAGGTACTTCTTCCT
GAAGCCATATTCGGGACGGATTTACCACCAATGCCAGCTTCAGCACCAGCACCAGTAACGGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297233] SGN-U567096 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109648 [Download] [View] Facility Assigned ID: TMEEI10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5