Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E297690

Search information 
Request: 297690Match: SGN-E297690
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84340Clone name: cLET-28-G9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297690Length: 643 bp (900 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E297690 [] (trimmed) TTCCACAGGAACAAACAATCATGAGAACTATTTCCCTTCATTCAACCTCATTTTCACTTGTTGAGTTCCATGGTACCAAGAATTTGGCACAAAGC
AGGATCAATAGATCGGTTTCGTTGATTCCAATGGCGAGGTCTCAATTTCAGCCTAAAATAAGACGTGACATTGGTACTAGCAATAGAAATCCAAG
TTTTAGCTGGATGGCAACAGTTGGAGAGAAAGTGCACAACTCCACGGTTCCTACTTCTGTTCCTGTTCGAGTTGCACTTGAATTGCTTCAAGCTG
GCCATCGTTATTTAGATGTCAGAACTACTGAGGAGTACAATGATGGGCATGCTGCTGGAGCCATAAACATTCCTTACATGCTTAGAATTGGCTCA
GGGATGATAAAGAACCCCAATTTCTTGGAGGAAGTGTTGGAACAATTCGGGAAGGATGATGAGATTATAGTTGGATGCCAGTTGGGTAAGAGATC
ATTTATGGCTGCAACTGAACTTCTTGCTGCTGGATTTACTGGGGTGACTGACATTGCTGGTGGATATGCTGCGTGGACAGAGAGTGGACTTCCGA
TTGAGTCTTGAAGGCCTTTTATTTACTCACATATAAAAAGGGTAGATTTTTAAATAAGTACACACCAGTAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297690] SGN-U566924 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109484 [Download] [View] Facility Assigned ID: TMEEE41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5