EST details — SGN-E297887

Search information 
Request: 297887Match: SGN-E297887
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85164Clone name: cLET-38-E4
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182156 is on microarray TOM1: SGN-S1-1-7.2.10.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182156 [TUS-38-N10] Trace: SGN-T187803 EST: SGN-E374533 Direction: 3' Facility: INRA
Clone: SGN-C182156 [TUS-38-N10] Trace: SGN-T187804 EST: SGN-E374534 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297887Length: 274 bp (897 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E297887 [] (trimmed) GATTCGTGAAACTGAGGTTGTCAACAAAGGCCATAAAGACCATTGAGAAAAATGGACTTGATGCTGTAGCCAAGAAAGCTGGGATTGATCTCAGC
AAGAAGTAGAACCTGGAACCTGATAGCATATTTGTTTGGACACTAATTTTGATGCCCTCAAAAACCATAACTTTATTTTTTGGCATTGCTTGTTG
ATTTGTAGTTATATGTTTTCATGATATTACTCTCCAAGCATATCTTGATCACCTACTTTCAATGAATATCAACATCATTCTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297887] SGN-U582646 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109966 [Download] [View] Facility Assigned ID: TMEFT26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5