EST details — SGN-E298050

Search information 
Request: 298050Match: SGN-E298050
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89236Clone name: cLEW-12-I2
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191589 [TUS-63-G11] Trace: SGN-T343084 EST: SGN-E542209 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191589 [TUS-63-G11] Trace: SGN-T343087 EST: SGN-E542212 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298050Length: 464 bp (845 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298050 [] (trimmed) GCCTCGTGCCGAAAAACCCTCTTGCCACCGGTTCGCCACCGCCTGCGGCAAATCCGCCTCTCTTGTCGCCGTGAAGTACTCTGCCTGGGGTGGGT
GGGAGTCTTCAATCCCAAACTCTCGATGATACCGGCTGCTCTTCTATTGCAGTGTGGCACCTGGAATCTCTAAATTCTGAAGCCTCTCTTTGACC
GACTTTGGTGAAATACTCGTCTCTTTCTCAAAGTAAAATCTGAGTTATGGAGAATTCAAATACTCCAGCATCTGATTCGAACGCTGCCAAAGCTG
AAGCTGAACAGCTGCCAACAGCTCCCGTATGCAATTTTTTCAAAAAACCATCCAACGGAAAAAATATCAGAAAGCGGCCTACAGTTGAAGAGGGA
GAGAATGAAGATGCATAATGAGATCGTCCAGTCATATATACCAAGAAAAAGCCAGCGGTTGCGAATAATAAGCTGCACTTATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298050] SGN-U595835 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113044 [Download] [View] Facility Assigned ID: TRDBT49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0260 Quality Trim Threshold: 14.5