EST details — SGN-E298239

Search information 
Request: 298239Match: SGN-E298239
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89596Clone name: cLEW-18-C2
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
See unigene SGN-U568655 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298239Length: 513 bp (951 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E298239 [] (trimmed) GGTTTGTTACTGGTGCTCCTCGGCTCCCCGCAGCTGTGGAAGCGTGAGACGCTAGGGGATCACATAAAATTCGATCATGGATTCACATCCAAGAG
TCCTCCTATTATTCATTTACTAGAGATTATGGGAGAGTTCACACCTGAGCAGCAACGAGCATTCTGCCAGTTTGTTACTGGTGCTCCTCGGCTCC
CCGCAGGTGGTCTTGCTTCTCTGAATCCTAAGTTGACAATTGTGAGGAAGCATTCATCTAGTGCTGGCAATGCAGCACAGAACAGTAATGCCCCA
TCAGAATCTGCAGATGAAGACCTACCCAGTGTGATGACATGTGCTAATTACTTGAAACTCCCTCCCTATTCTACTAAGGAGATCATGTCCAAGAA
ATTACTCTATGCCATTAATGAAGGTCAAGGATCGTTTGATTTGTCATAAGTCGGAGTAACTAATAGACTTGTTTATACAACTCGAGAATTGGTGC
TTCTGATCCTTGATAATGGTGCCGTCAAACCACCCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298239] SGN-U568655 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113419 [Download] [View] Facility Assigned ID: TRDCR13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5