EST details — SGN-E298437

Search information 
Request: 298437Match: SGN-E298437
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85826Clone name: cLET-41-C1
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182196 is on microarray TOM1: SGN-S1-1-7.4.10.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182196 [TUS-38-P2] Trace: SGN-T187742 EST: SGN-E374472 Direction: 3' Facility: INRA
Clone: SGN-C182196 [TUS-38-P2] Trace: SGN-T187743 EST: SGN-E374473 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298437Length: 573 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298437 [] (trimmed) GGCCCAATGCCACAGACCAAAGAACATATCTTGCTTGCTAAACAAGTGGGTGTTCCTAATATGGTGGTGTTTTTGAACAAACAAGATCAGGTTGA
TGATGAAGAGCTTCTTGAGCTTGTTGAGTTGGAGGTAAGAGAGCTTTTGTCTAGTTATGAGTTCCCTGGTGATGATATTCCTATTGTTTCTGGCT
CTGCTCTTTTGGCTTTAGAGGCTTTAATGGCAAATCCTAGTATTAAGAGAGGTGAAAATGAATGGGTTGATAAGATTTTTACATTAATGGACAAT
GTTGATAGTTATATTCCTATTCCGCAAAGACAAACTGAGTTGCCTTTTTTGATGGCTATTGAAGATGTGTTTTCAATCACTGGTAGAGGTACAGT
GGCAACAGGGAGAGTAGAGAGAGGGACTGTTAGGGTTGGAGAGACCGTTGATATTGTAGGATTAAGAGACACCAGGTCTACTACCGTGACCGGGG
TTGAAATGTTTCAGAAGATTTTGGATGAAGCAATGGCTGGTGATAATGTGGGATTGTTGTTGAGAGGTATTCAGAAGATTGATATTCAAAGAGGA
ATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298437] SGN-U578104 Tomato 200607 Build 2 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110474 [Download] [View] Facility Assigned ID: TMEGE13THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5