EST details — SGN-E298456

Search information 
Request: 298456Match: SGN-E298456
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85957Clone name: cLET-41-I3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184793 is on microarray TOM1: SGN-S1-1-2.4.14.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184793 [TUS-45-L7] Trace: SGN-T198727 EST: SGN-E397401 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298456Length: 417 bp (882 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E298456 [] (trimmed) TCTCTCTTCACTTTTCTCAGTATCACTTCTCAACAGAAATGGCGGTCTCGAAGGCAACTTCATCAGTCCTTGCTGTAATTGTCGTTGTTTGTTTT
CTCATCGGAACTACAATAGCTGCCGACGCACCTGCACCGGCACCTGCTTCTTCCGCCGGATCTATGTCTCCGTCATTCGCCGCTGGCTGTGCTGT
CACTGTTTTCGCTTTCCTCTTCGGATCTGCACTCAGGATCTGAAGTTTTTGAAGAGTAGAGAGTGAGATGAGTTTGTCTCAATTTTCTACTGCTT
ATTCATTGTTTGCATTTCAGATTTCTTCGTGTTTTCTGGTGTATATGAATATATGATATGTTACTAGGAACTGCTTCGTGTATGTATAGTCTATG
CATTTCTTCTGTTCTATGGATTATTTCTGCGTTTTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298456] SGN-U577577 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110493 [Download] [View] Facility Assigned ID: TMEGE50THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0132 Quality Trim Threshold: 12.5