EST details — SGN-E298715

Search information 
Request: 298715Match: SGN-E298715
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86995Clone name: cLET-44-P23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179947 [TUS-33-B9] Trace: SGN-T186787 EST: SGN-E374173 Direction: 3' Facility: INRA
Clone: SGN-C179947 [TUS-33-B9] Trace: SGN-T186788 EST: SGN-E374174 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298715Length: 387 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298715 [] (trimmed) CTCCAACAGAGCAATATCTGGTGTTCCTCTACCGCCTAACCTGTGGATCATGCCCGGAGAGCTATGGCATGCAAGTAGCCCTTATGGCTGGAATA
CCGAAAACTGTGGTTGAATCTGCATTGAGTGCGGCGCAAGTAATGGAGAAAATGAACAGAGAAAGTTTTAAGTCTTCTGAACAAAGAGCTAACTT
TTCAACACTGCATGAGCAATGGTTCACGACTCTTCTGGATATCTCGAAGACGGATGGTGGACTAAATAGTGACAATGATGACGACAATGACCTAT
TTGATACATTGTTTTGTTTGTGGCATGAACTTAGGGCTGATAGATCCACTTGCTGAAAATGTTGGTCTTTTGAATAGACCATTATGCTGTAAACT
GATGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298715] SGN-U567784 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111351 [Download] [View] Facility Assigned ID: TMEGS96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0175 Quality Trim Threshold: 12.5