EST details — SGN-E298841

Search information 
Request: 298841Match: SGN-E298841
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86914Clone name: cLET-44-L15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181664 is on microarray TOM1: SGN-S1-1-3.1.12.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181664 [TUS-37-I22] Trace: SGN-T194164 EST: SGN-E392838 Direction: 5' Facility: INRA
Clone: SGN-C181664 [TUS-37-I22] Trace: SGN-T199278 EST: SGN-E397952 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298841Length: 410 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298841 [] (trimmed) ACACTCTGTGTTAGCTCCTTCTCTGTAAACACCACCCACCCCCATCGTCCATGGCGGGTCTCACCACCAGTACTTCCTTCACCTTGACACCCATT
TCCTCTAAACCCATAACCAACAAACCCCTTTTCCTCCATTACCTTAATTCTTCCATTTTTGGGCTTCGATTTCATAATCCTCAGCTTCGTTCTTG
CTCTTCACTTATCTACCATTCAGCCACTATCTCCGCTAGATACGGTGGCGGAGGTGGTAGAGGAGGATTCCGGCCGCCCCCACGTTCCGAGGAAG
ATGAAGCACTTGATATTTCATCTATCAGGTCAGACAAGGTTAGGCTCATTGATGATAAGCAGAACATGTTGGGGATAGTGTCGAAAATGGAAGCC
CTTCAGAGAGCTGAGGATGCAAGCCTTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298841] SGN-U584629 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111477 [Download] [View] Facility Assigned ID: TMEGS68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5