Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E299067

Search information 
Request: 299067Match: SGN-E299067
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86272Clone name: cLET-42-I7
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299067Length: 424 bp (922 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E299067 [] (trimmed) GAGCATGGTGGCTCCTGAAAATGAGGTGCGTCATGCTGGTGATCTTGGTAACATCACAGTTGGAGAAGATGGTACTGCATCTTTTACTATTACCG
ACAAGCAGATTCCTCTCACTGGTCCACAGTCCATCATTGGAAGAGCTGTTGTTGTTCATGCTGATCCTGATGATCTTGGAAAGGGAGGACATGAG
CTCAGTAAAAGCACCGGAAATGCTGGCGGAAGGATTGCTTGTGGTATTATTGGCCTCCAGGGTTAACTGCTCCGGTGAGGTGAAGATTCAGCAAC
TAGCGGTGGTGTCTGTCTTAGAATAAAGTTATATTGGAGCTGCTGAGCCTTGTTTTCTATGTATTTATCATTTGACGCCTTTTGAATTGGGGTTG
AACCATTCATAATACATGACTGTAGTGCTGCTTTTCAGTGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299067] SGN-U581590 Tomato 200607 Build 2 168 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110808 [Download] [View] Facility Assigned ID: TMEGI52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0278 Quality Trim Threshold: 14.5