EST details — SGN-E299429

Search information 
Request: 299429Match: SGN-E299429
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86468Clone name: cLET-43-D5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191257 [TUS-62-I15] Trace: SGN-T342514 EST: SGN-E541639 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191257 [TUS-62-I15] Trace: SGN-T342517 EST: SGN-E541642 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299429Length: 391 bp (882 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E299429 [] (trimmed) TTTGTTGCAACTTAGCTTTTAGCGATGGTGGAAATAGTATATGATTTTTTCCCATTTATGAGAGTTTACAAAGACGGTCGAATCGAAAGGCTGAT
GGGCGAAGGTTTTGTCCCACCAGAATCAGATCCTGAAACCGGAGTACAAATCAAAGACGTTCAAATTGATCCACAAATTAACCTATCAGCAAGAC
TTTACCTGCCCAAACATGTGGACACTGTTGAGAAAATTCCTCTTTTTGTCTACTTTCACGGCGGTGGTTTTCTGATCGAATCTGCTTATTCACCT
TCATATCACAAGCATATAAGCAAAGTAGCAGCTGAAGCAAAAGTAGTTATTGTTTCTGTTAACTACAGGTTAGCTCCTGAGTACCTTTTACCCAT
AGCTTATGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299429] SGN-U568100 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111170 [Download] [View] Facility Assigned ID: TMEGO15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5