EST details — SGN-E299655

Search information 
Request: 299655Match: SGN-E299655
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90031Clone name: cLEW-1-G17
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90031 [cLEW-1-G17] Trace: SGN-T111884 EST: SGN-E299654 Direction: 5' Facility: TIGR
Clone: SGN-C191321 [TUS-62-L7] Trace: SGN-T342624 EST: SGN-E541749 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191321 [TUS-62-L7] Trace: SGN-T342627 EST: SGN-E541752 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299655Length: 593 bp (930 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E299655 [] (trimmed) CCCCTCGAGTTTTTTTATTTTTCTTTTTTGGAAAACAGTAGATATAGTTAATTAATTGTTTCTGCTGCTTTGTTTTTTACATTAGAGAAATGAAA
TAGATTATGACTGGGATATTCACAAAAGGAAGTTGACTATATCAGTAAAAAAGAAAAAATGAAAGTGGAGGAGAGTGAGTAGTGAGTAGTAGTTA
ATCACAGAAAAAAACTTGAACAAAATCAAATACCAATTCCAGATGATCAACTTTTAGTTTATCTAGGCTCTATCCAACTCTCCGTCAATTTATTC
CCAGAAGATTGTGTCGAGGAGCTTGGTTGGCCGAAAAATCTTTTCCCATGCAGATTAAATGGACTAAATTCTGAACTACCAGAATTGAGGAATGG
TGGCTGTGTTGGCTGAGGAATTTCATGGTTCTCGCTGAGCATTTTCACGACACTTGACATAGAGGGTCGTAGTTCTGCTGATGCTTGTACACAAA
CAAGACCTACTTGAAGCAGTTTAGATGCCTCCTCTTTATTGAAGTTACCTTCTAATAAAGGGTCAACTGCTTCATTAGATTTTTCCATCCCATAC
AAGTTCCACAACTGTTGCAGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299655] SGN-U582278 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111885 [Download] [View] Facility Assigned ID: TRDAA45TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0086 Quality Trim Threshold: 20.5