EST details — SGN-E299719

Search information 
Request: 299719Match: SGN-E299719
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90156Clone name: cLEW-1-O12
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191355 [TUS-62-M17] Trace: SGN-T342683 EST: SGN-E541808 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191355 [TUS-62-M17] Trace: SGN-T342685 EST: SGN-E541810 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299719Length: 321 bp (907 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E299719 [] (trimmed) GCTTATTTTTTTTTACTTTGCTTAAATGCTTTTTTACTAATCAAATACTTACATATTAAAGTTGGAGGATAGATTATCAATTACTACAATTTATT
TACCATTCACGAAACTTTGCTTGAGATTAAAACAGATTGATTAACACATACGGTTGCACACAATATATGCTGATCAATCAAACCTTTAGATCATT
GGGAGACCCGACCCGACATTCCATCACCTTCGGATCCCTGCATTTCTTCGATAACTGGACCTCCGTAACCCGGAACAACTTCTGAATTCCTAACT
GCATAGGAATTCGTTCCTTCGAGAACAACTCTTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299719] SGN-U585430 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111949 [Download] [View] Facility Assigned ID: TRDAB90THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0267 Quality Trim Threshold: 14.5