EST details — SGN-E299840

Search information 
Request: 299840Match: SGN-E299840
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89952Clone name: cLEW-1-A6
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191293 [TUS-62-K3] Trace: SGN-T342576 EST: SGN-E541701 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191293 [TUS-62-K3] Trace: SGN-T342579 EST: SGN-E541704 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299840Length: 517 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E299840 [] (trimmed) GCACCAATAGTACATTTTTTTCCAACTAAAAAGTACAACAATCTTGCTTCAAAATTCTCAAATCTTGTATACATTTCAGTCCAAATCTCACTAGA
TAAAATCTTGAAATCTGACCTGAGAATCTTGGGGGAAAAAAATACCCTTTACAAATGGTGTTCTTGTTTGGGTAACATTTTTCTGAGACCCCAAA
AGTGCGCTTTTCATTGTAAAGCATCAATCTTTACTACTAATTGCTGAAATCTTCAGTACCCTTGAAAAAATCTTGAAATTTAATCTTGAAAATAT
AGCTTTACAAGTGGTGCTCTTCTTGTTTGGCTTGGCTGTGTTTCTGTAACATTTCTCGCAAACCCCCCCCAAAAGTGCTTTTTTCATTATAAAGC
AACAATCTTTACTACAAATCTTGAAACTTGGCCTGAAAATCTTGAAAACCCCCTTTTGGAAATGGTTTATAGTTGTCTTGTACTACTCTGTTCAT
TCATTTCCTTTTCAATCCTAGCTTCATCTCAGCAACTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299840] SGN-U585344 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T112070 [Download] [View] Facility Assigned ID: TRDAB03THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5