EST details — SGN-E299893

Search information 
Request: 299893Match: SGN-E299893
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90012Clone name: cLEW-1-F10
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299893Length: 274 bp (905 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E299893 [] (trimmed) GGAATTTTGTAAGCAATTCACCTACAATATAATAACTTTGTTTTTTCTAGATTTTGAGCATAAGCTCCCAAGAAAACTCAGTATTATTGTTAAGG
GCGAAACACTTTCCCGTCAGTGCCAGTGCATCACAACCCATGTTGATATGAAGAAATAATTGTTAGAATAATTGTTAGCTAGAGATTACGTGTGA
GGATTATTAGCTGAAACACCTACTTAATTTGAGTATCAAACGCGTGGTTAATGGAATTCATATGCTCTCTACCTAAGGAAACGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299893] SGN-U584596 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T112123 [Download] [View] Facility Assigned ID: TRDAD29THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0188 Quality Trim Threshold: 14.5