EST details — SGN-E300234

Search information 
Request: 300234Match: SGN-E300234
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89567Clone name: cLEW-17-O18
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191662 [TUS-63-J12] Trace: SGN-T343210 EST: SGN-E542335 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191662 [TUS-63-J12] Trace: SGN-T343212 EST: SGN-E542337 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300234Length: 566 bp (846 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300234 [] (trimmed) GGTTTCTCTTCCCCTCAACGGGCCGTCCTACTCAAAAACGGCGTTTGTCGTAATTCCGTTAACTGACGTGGTTCAAAAAGTAGTATGAAGCTTGA
GCGATTGACCCTAATTCCGTCTACCGACTCCGACGGCCGTCTCAACGGCGCCGATGATTCTAACAAAGTTCCTAGGCTTCCTCGTTGGACTAGAC
AAGAAATTCTTGTACTGATACAGGGGAAAAAGGTTACTGAAAACCGGATCCGTCGAGGACGAACTGGCGTTGTTGAATTAGGTTCACCACAGGTT
GAACCCAAGTGGGCTTCTGTTTCTTCCTACTGTAAAAGACATGGGGTTAACCGTGGACCAGTTCAATGCCGAAAGAGATGGAGTAATTTGGCTGG
AGATTTTAAGAAGATTAAAGAGTGGGAGTCTCAGATAAAAGAAGAAACCGACTCCTTTTGGGTCATGAGGAATGATTTGAGAAGAGACAAAAAAT
TACCTGGATTTTTCGATAGAGAAGTCTATGATATTCTTGATCGTGGAAGTGGAGATGCCGATGCCCATGAAGAAAGAGGCTTGGTTTTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300234] SGN-U568380 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113282 [Download] [View] Facility Assigned ID: TRDCN93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5