EST details — SGN-E300462

Search information 
Request: 300462Match: SGN-E300462
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87185Clone name: cLET-45-J11
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
See unigene SGN-U575006 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C180012 [TUS-33-E2] Trace: SGN-T186555 EST: SGN-E373590 Direction: 3' Facility: INRA
Clone: SGN-C180012 [TUS-33-E2] Trace: SGN-T186556 EST: SGN-E373591 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300462Length: 420 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300462 [] (trimmed) GTGATTCTGATGTTGGCTACTGCCAGGGATTAAACTATGTTGCAGCATTATTATTGCTGGTGATGAAAACCGAAGAAGAGGCTTTCTGGATGATT
GCTGTCCTTCTAGAGAATGTGTTAGTCACCGACTGTTATAATAAGAACTTATCTGGATGTCATGTTGAACAAAGAGTGTTCAAGGATCTATTAAC
CAAAAAATGTCCAAGGATAGCCGCTCATTTGGAGGCACTGGAGTTCGACGCTTCTCTTGTTTGCACCGAATGGTTTCTCTGCCTTTTCGCCAAAA
GCTTGCCTTCTGAGACAACCTTGCGGGTCTGGGACGTCCTTTTCAATGAAGGTGCAAATCTTCTATTTCATGTGGCATTGGCAATTTTTAAGATG
AACGAACAAGAGTTGCTGACGGTGCATCATGTTGGGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300462] SGN-U575006 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111634 [Download] [View] Facility Assigned ID: TMEGW54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0195 Quality Trim Threshold: 14.5