EST details — SGN-E300475

Search information 
Request: 300475Match: SGN-E300475
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87315Clone name: cLET-45-P19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191291 [TUS-62-K1] Trace: SGN-T342573 EST: SGN-E541698 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191291 [TUS-62-K1] Trace: SGN-T342575 EST: SGN-E541700 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300475Length: 492 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300475 [] (trimmed) AATCACTTGGTTTTCAGCAATGGCTTCTTCAGTAATGTCCTCAGCAGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCACCCT
TCACTGGACTCAAGTCCACCGCTTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGC
ATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTGTCGAACCTTCCTGATTTGTCCGACGAGCAATTGCTCAACGAAATTGAGTA
CCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACCATCAGTGCACCCAAACATGGGCAA
CTTACACATGGTCCAGTATCTGCCATCGTAGTATCCTGGTTAAGCCCGCGCTTATCTTCATCTTTCTCCTCTGATTCTGGACATTTTTCTCACCG
GAAAACTCAATCAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300475] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111647 [Download] [View] Facility Assigned ID: TMEGW94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5