EST details — SGN-E300645

Search information 
Request: 300645Match: SGN-E300645
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87289Clone name: cLET-45-N9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180054 [TUS-33-F20] Trace: SGN-T186895 EST: SGN-E374281 Direction: 3' Facility: INRA
Clone: SGN-C180054 [TUS-33-F20] Trace: SGN-T186896 EST: SGN-E374282 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300645Length: 511 bp (871 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300645 [] (trimmed) GAAACAGAGTCATCAAAATTTGGGGAAAATTCTTACAAGAGAATCGAATAGATTTTGATTTGAGGAAAAAAAGGGGTGGTGTTGAAGTGGATTTG
TGATGGTAAGGAGTGTTTGGTTGTGAGTAAAATTCGGTTTTTCTTTTTTGGGTTTTGGGTGGTTGGAGTAAAGAGCGAAAGAGAAGGAAAATTGC
AGGTATGAATAGAGGAGGAATTGGAATTGGAGGGCCAATGCGAAAGTCTTTTAAGGACTCTCTTAAAGTTCTTGAAGCTGATATTCAGCATGCTA
ATACTCTGGCATCTGACTTTCCCCGAGAGTACGATGGGGCCTGCCTACAGATGAGAATGTCCTACAGTTCAGCAGCGCACCTGTTCCTTTTCTTA
GTCCAGTGGACTGATTGCCACCTTGCTGGTGCACTTGGATTGTTGAGAATTCTTATTTACAAGGTTTATGTTGATGGCACCACAACCATGTCAGT
TCATGAAAGGAAAGCAAGCATTAGGGAGTTCTATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300645] SGN-U568639 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111817 [Download] [View] Facility Assigned ID: TMEGW77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0123 Quality Trim Threshold: 14.5