EST details — SGN-E301084

Search information 
Request: 301084Match: SGN-E301084
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90360Clone name: cLEW-22-D24
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: Alias clone SGN-C186085 is on microarray TOM1: SGN-S1-1-6.2.5.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301084Length: 577 bp (1041 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E301084 [] (trimmed) CTTTTCATCCAAGAAGGTATGTTACGATGAGATTTGTCAAGAAATTGGAACAGATGGTAAAAACATGGGTGGTTGGTGATCCTTTTGATCCAAAT
TCTCATCAAGGACCTCAAGTATACATCTGAACTGTTCTTTTAAAATTTTTTATACTTGTCAATCGCAAATGTATTTCACCGTGTCTATATCTAAT
TCACTGTTTACATAATGCAGGTTGATAAAAAACAGTACGAGAGAGTACTTTCGTACATTGAACATGGCAAGAGGGAGGGTGCGAAACTGCTAACT
GGGGGCAATGCATTGGATAGGAAGGGTTATTTCATTGAGCCAACTATATTTATTGATGTTGAAGTAAGCATTTTTTAACTCATCATTGTTGCATT
TTGAATGCTGAGATGAGGTATACAATAATTTACTTACATCTTCATAGATAAGTGGGTATGAAGTTCACGGACTAAGATAGAAGGCTAGTACGAGA
TAAGGCTTGATGTTAGTCTGCTGCATCGTGTCTGTCGTAGTATTAGCCTTATTCATTTGTATGTTTGTGTTGGTTACTTACGTCTTCATAATGCT
TTTGGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301084] SGN-U572155 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113982 [Download] [View] Facility Assigned ID: TRDDJ24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5