Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E301306

Search information 
Request: 301306Match: SGN-E301306
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90919Clone name: cLEW-24-N2
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301306Length: 385 bp (852 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E301306 [] (trimmed) ACCCTAAGGGAAACAATCGCTAAATCTTCAAATAATCACTTTTCTCTTTCCCAATTTTGATCAATTACAGCTATGGCGACCAGTGGAAACAAGAA
TATGAACGCCAAATTGGTGCTCCTTGGGGATGTTGGAGCTGGAAAATCTACTCTAGTTCTGCGTTTTGTTAAAGGACAATTTATTGAATTTCAGG
AATCAACCATACGTGCTGCATTTTTCTCTCAAACAGTAGCAGTAAATGATGCAACTGTCAAATTTGAAATATGGGATACAGCACGCCAAGAGAGA
TACCACAGTCTAGCTCCAATGTATTACAAAGGTGCTGCAGCTGCTATTATTGTTTATGATATAACAAATCAAGCATCATTTGATAGAGCAAAAAA
ATGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301306] SGN-U565736 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114429 [Download] [View] Facility Assigned ID: TRDDR73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0164 Quality Trim Threshold: 14.5