EST details — SGN-E301388

Search information 
Request: 301388Match: SGN-E301388
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90874Clone name: cLEW-24-J12
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191920 [TUS-64-E6] Trace: SGN-T343659 EST: SGN-E542784 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191920 [TUS-64-E6] Trace: SGN-T343660 EST: SGN-E542785 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301388Length: 448 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E301388 [] (trimmed) GCCGTTTTCAACAATATCTCAGAATCAACACTGCCCATCCTAACCCAAACTACACTGCCGCCATTAACTACCTCACTAACTTCGCCAACTCCATC
CCTAATCTCCACTCCAAAATCATTCACCTTACCCCTACTTCGCCTCTCCTCCTATTAACCTGGCCAGGTTCAAACCCTTCACTCCCCTCCATTCT
TTTCAATTCCCATCTTGATTCTGTCCCTGCTGAACCACATAAATGGACCCACCCGCCGTTTTCCGCTCACAAGACTTCCGATGGAAGAATATTTG
CACGGGGAGCGCAGGATGATAAGTGTATTGGTATGCAGTATTTGGAAGCAATCAAAGCGATTCAAATGAGTGATTCAAAATTTGTGCCACTGAGA
AATGTTCATATTCTGTATGTGCCTGAAGAGGAGGTTGGTGGGTTTGATGGGATGGGGAAGTTTGTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301388] SGN-U582789 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114511 [Download] [View] Facility Assigned ID: TRDDR54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5