EST details — SGN-E301462

Search information 
Request: 301462Match: SGN-E301462
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95100Clone name: cLEX-8-G14
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192297 [TUS-65-D23] Trace: SGN-T344307 EST: SGN-E543432 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192297 [TUS-65-D23] Trace: SGN-T349752 EST: SGN-E548877 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301462Length: 453 bp (735 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E301462 [] (trimmed) GGGCAGACATCAAATTCCCCGTCACGCAGTAGAGTACAGCCAAACTAGTTTCTTGTTGATGACATAGTTTGCTCAATCCTAGAGCTAGATTCACA
CACTCCGCTACTATAAAATTTGTTCTTCCCCCTCGTCTTGGTTGCCTTTATCGTGCGCCCATCTCTCTTGGGAACTTGAGTTTTGCTGCTGAGAT
TTGACCATGGGTAATGCTTCTTCGATGTTGACTCAATATGATATTGAGGATGTTCAAGACCACTGCGACCATCTCTTTGCACAGCAGGAAATAGT
GTCACTGTATCAGAGGTTCTGCCAACTTGATCGGAATTCAAAGGGTTTTATATCAGCTGATGAGTTTCTCTCTGTGCCAGAATTCGCAATGAATC
CACTTTCTCAGAGATTGCTTAAGATGGTGGATGGCTTGAACTTCAAGGACTTTGTGGCATTTTTATCAACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301462] SGN-U581483 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115989 [Download] [View] Facility Assigned ID: TRXBD43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5