EST details — SGN-E301546

Search information 
Request: 301546Match: SGN-E301546
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90747Clone name: cLEW-23-O8
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301546Length: 339 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E301546 [] (trimmed) TTGCACGAGGGAGTTTTGAGATATTTGACAACGTTGAAACCGAGAGGACCTTGAGTCAGTGAAATATTGAAGCAGAAAATTGTGATTTTCGATTA
TGGATTAAGGAATTTTCGTCTGGAATTGATAGGAATTGGAATAATTGGAGGGATGTTGAGGTTCACGAGGTGGTGAAGGTAGCAAAGTAGTTGCC
GGGGCTATGGATTCCGGTGATTGGAAGACTAAACTTTTGCGTGATTTGCGTCAAAGGATTGGCAACATTATGTAAGTTTTTTATATATTTGTTTT
TGTGACTTGTTCTTTAATTTTTAAAAGGATTTTGGAATTTTGAATTTTAGGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301546] SGN-U565361 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114183 [Download] [View] Facility Assigned ID: TRDDL88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.909 Expected Error Rate: 0.0208 Quality Trim Threshold: 14.5