Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E301640

Search information 
Request: 301640Match: SGN-E301640
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90744Clone name: cLEW-23-O3
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191878 [TUS-64-C12] Trace: SGN-T343587 EST: SGN-E542712 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191878 [TUS-64-C12] Trace: SGN-T343588 EST: SGN-E542713 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301640Length: 537 bp (912 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E301640 [] (trimmed) GAGTTAGCGCTAGTAATTGATGGGAAGGTGTTAATGTATGCCTTAGACCCTAATCTTCGTGTAATGTTGTTGAACTTGAGCTTGAATTGCAGTGC
AGTGGTTTGCTGTCGTGTTTCTCCTTTACAGAAAGCTCAAGTAACCAGCTTGGTTAGGAAGGGGGCTCAGAGAATTACACTTAGTATCGGTGATG
GTGCTAATGACGTGAGTATGATTCAAGCTGCTCATGTTGGTGTTGGAATAAGTGGACAGGAGGGAATGCAAGCAGTGATGTCTAGTGATTTTGCA
ATAGCTCAGTTCCGCTTTCTCACTGATTTATTGCTTGTCCATGGACGCTGGTCATATCTTAGAATATGCAAGGTGGTGACATATTTCTTTTACAA
GAATCTGATGTTTACACTCACTCAGTTTTGGTTTACCTTCCGCACTGGATTCTCTGGTCAAAGGTTCTATGATGATTGGTTCCAGTCTCTCTACA
ATGTGATCTTCACAGCGCTTCCTGTTATTATTCTTGGGCTTTTTGAGAAAGATGTCAGTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301640] SGN-U565325 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114277 [Download] [View] Facility Assigned ID: TRDDK86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5