Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E301733

Search information 
Request: 301733Match: SGN-E301733
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95205Clone name: cLEX-9-P8
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192318 [TUS-65-E20] Trace: SGN-T344343 EST: SGN-E543468 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192318 [TUS-65-E20] Trace: SGN-T349758 EST: SGN-E548883 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301733Length: 412 bp (775 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E301733 [] (trimmed) GCAGATATGCCCAGATCAAGATTCAAGAGGAGGAAGACTCTGAACAAAAGTCCTCTGAGCTCAATGCCTAGGAAAGTTGTGGAAGAAAACTCTTG
TACAACAGAGAACAATTACATGGCTTTGGTGCCTGTTAAGCCTATTGAAGTCCGGGAGTCAAAGTCTCGCTGGACACTGCTTCGACGAGTGTTTC
TTCAGAACTTAGTGGCACCTGATAAATTTCCCGCGAAAAGGTCCTCTGTGATTCATTGGGTTTGGAAGCGACCAAGTCGGCAATCTTTTGCAGCT
ATCTACCCTGATCATAAACAGAGTGTATCTGACAAGGATGAGCCTCATCATACAAACTTGGATGCAGAGAAGGGGGCAATTATTCCTGTTGGAAG
TGATGCTAATCCAATTTCAAATGAATTTATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301733] SGN-U563034 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116518 [Download] [View] Facility Assigned ID: TRXBJ88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0129 Quality Trim Threshold: 14.5