Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E302249

Search information 
Request: 302249Match: SGN-E302249
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89679Clone name: cLEW-19-B21
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191692 [TUS-63-K18] Trace: SGN-T343264 EST: SGN-E542389 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C191692 [TUS-63-K18] Trace: SGN-T349580 EST: SGN-E548705 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302249Length: 662 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E302249 [] (trimmed) GCTGGATTGATCCATTTTCAATATGAAGAGGTAGCAAATCAAATGAAGTTTCCCTTTCATTGAACAATACAATTCTCACATTCCTTTCATGCATA
TCATATAGTGGCTAATGAGCTGCTTCCTCTAAAGCGGAACCGGCTGATTTTGTCTAATGCTCTACAAAAGTGGTCAAAGGGAGAGGGAAGAAGTG
AAGGACTGCTGTAACTAGGATCTTGTTTTTGCATTTTTGTCAGCCAGATCAGTGAAAACATAATGAAGCTCCAGTCTTTACTGGCAGCTATTGTT
TTTCTTATTTCGCTGCTATCAGTATTTCTTAATGTTATAGCTGATCTTGATTCCGATAGACAGGCGCTACTCGACTTTGCAGAATCTGTCCCTCA
TATCCGAAAACTCAACTGGAATTTGGCTCTCCCTATTTGCAAATCTTGGGCTGGTATAGCTTGTAACGAAGATGGAACGAGAGTCATTGCAATCC
ATCTCCCTGCTGTAGGACTTTTTGGTCCTATCCCAGCTAATAGTATAGGCAAGCTAGATGCTCTTAAGGTCCTTAGTCTAAGAGCCAATTATCTT
AATGGAAGTGTTCCTTCTGATCTCCTTTCGATCCCGTCTCTCCAATCTGTCTACCTTCAACATAATAGCTTCTCTGGTGATATTCCTGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302249] SGN-U563473 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113673 [Download] [View] Facility Assigned ID: TRDCW11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5