EST details — SGN-E302424

Search information 
Request: 302424Match: SGN-E302424
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91367Clone name: cLEW-27-C18
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: Alias clone SGN-C182475 is on microarray TOM1: SGN-S1-1-8.3.7.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302424Length: 580 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E302424 [] (trimmed) GGCTCCGCCTCCCACCACCGTCTAATTTGTAAATATATTCGCCGGAAACTTCTCTATCCACGCTTTCTCTATATCTATCATACCCTTTTTCTTAA
TTAATCGGTTGCTATTCCTTTGATGGCAGCGATTACGCAGAGAAAAGATTCGGATCGGATCAAAGGTCCATGGAGTCCTGAAGAGGACGAGTTGT
TGCAGACGCTTGTTGAGAAACATGGACCTAGAAACTGGACTTTGATAAGCAAATCGGTGCCGGGTCGATCTGGTAAATCCTGTCGTCTCCGGTGG
TGTAATCAGCTTTCACCTCAAGTGGAACATCGTGCTTTTACTCCTGAAGAAGATGATACGATCATCAGGGCTCATGCCAAGTTTGGTAATAAATG
GGCGACTATTGCCCGTTTGTTATCGGGTCGGACTGATAACGCTATAAAGAACCATTGGAACTCTACTCTTAAACGTAAGTGTCCTTCCATGTCCG
AAGATTTAAGCTTTGAAACCCCTCAACCGCCTTTGAAAAGATCGTCTAGTGTTGGTCCCTGTACCAATTTTTCTTCTGTTATGAATCCGGGTAGT
CCGTCTGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302424] SGN-U582039 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115007 [Download] [View] Facility Assigned ID: TRDEB21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5