EST details — SGN-E302522

Search information 
Request: 302522Match: SGN-E302522
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93917Clone name: cLEX-1-E7
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93917 [cLEX-1-E7] Trace: SGN-T115106 EST: SGN-E302523 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302522Length: 653 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E302522 [] (trimmed) GGTAAAAACCCATTAATTATGAGTGATTACAAAATCCCCAAAATTAATCTCACCAAATTAGACAAGCACTCAAATTCTTGGGTACCATTATGCAA
TGAGGTTCGACATGCCCTTGAAGAACATGGTTATTTTATAGCACTATATGAGGATGCTAATAATAAAATTTCCAAGGAAATATTTGATGTAATGG
AAGAATTATTTGATCTCCCCATCGAAACAAAGAGAAAAAACACTTCAGACGTTTACTTCTATCGTTACAAAGGTCAATTATTAACCGCTCCTCTT
CACGAAAGCTTTGGAATCCCACATCCAACTGATGTTGAAGCACTTCAAAGCTTCACCACACTTATGTGGCCACAAGGCAACCAAAGATTTTGTGA
AACAATGACATCGTACATAAAGGTAGGAGCAGAAATAGAACAGTTGGTTGATAAAATGGTGTTTGAAAGCTACGGATTACCAGAAAAGCACTACG
AATCTCATGTCGCAGCTACTACATACCTCCTCCGCCCCACCAAGTACAGAGCAGCACCTGCTGGGGCGGAGGACGGTATTGGCAATGTAGGTTCC
AATATACATACAGATAAAGGCTTCTCAGCGGTTCTATTTCAGAATCAGATAAATGCTTTGCAAATCGAAACAAAAAGTGGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302522] SGN-U569664 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115105 [Download] [View] Facility Assigned ID: TRXAA28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5