Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E302600

Search information 
Request: 302600Match: SGN-E302600
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93895Clone name: cLEX-1-C19
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93895 [cLEX-1-C19] Trace: SGN-T115184 EST: SGN-E302601 Direction: 3' Facility: TIGR
Clone: SGN-C192061 [TUS-64-K3] Trace: SGN-T343901 EST: SGN-E543026 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302600Length: 696 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E302600 [] (trimmed) GAAAACTTCAAGATAACAGATTAATCCAGATGTTGAAAGGCTTCCTCTTTGTTTGGCTTATTGCTTTTTCTTTAGCAACAATAGCTGTTGCACAA
AACAACCAAACAGGATTCATAAGCCTAGATTGTGGAATACCAGCACGTTCAAACTATACAGATATAACAACAGGACTATTTTACACTTCAGATGT
AGGTTATGTCAGTGGTGGGGTGAAAAATAACATATCATCAAAATACCAATCCAATTCCCTAGAAAGACAATTTCTCACAGTTACAAGCTTTCCAA
CAGGGACCAAAAATTGCTACACTTTGACTCCAGCTCAAGGAAACTCTGGCAGATACTTGATAAGGGCAAGTTTTTTCTACGGAGATTATGATAAT
GGAAATGATCGATTCCCCTATTTTGATCTTTACATTGAAGAAAAATATTGGATCACAATCTCAATTTATAATGCTTCTATACCAATTCAAGAGGA
AATTATACACACCCCTTCTAATGCCTCTATAAATATTTGCCTTGTCAAGTTAGATACAACAACTCCTTTCATTTCAGCCTTAGAGTTGAGGCCTG
TGAATATGACCATATACAAAGCAATACTCAACAGTTCAATGGAACTTTTTATCCGTCTTGACTTTGGTTCCTTAACCAATCAGTACGTTAGGTAC
AGCAATGATGCATGGGATAGAGTTTGGAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302600] SGN-U567709 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115183 [Download] [View] Facility Assigned ID: TRXAA22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5