EST details — SGN-E302707

Search information 
Request: 302707Match: SGN-E302707
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97188Clone name: cLEY-1-O11
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97188 [cLEY-1-O11] Trace: SGN-T118391 EST: SGN-E302708 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302707Length: 504 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E302707 [] (trimmed) GCTCTGCAGGAAGGCGGCCCGAGGGACACAACAGCGATACAGCCACCGCACCGTCGCCGGCGAAAATCGCCGCCCAGGAAGATGCGCTACTGAAG
CAATTCTTCGCTGAGGTCAGTGAAGTTGAACGCGATAATGAAGTTAACAGGATCCTTTGATAGAATCAAGTTGAATCCATTCGATTATCTTAACT
TGTCATTCGATTCATCCATTGATGAAGTCAAAAGACAGTATCGTAAGTTATCTTTGCTTGTTCACCCTGACAAGTGCAAGCATCCACAAGCAAAG
GAGGCATTTGGCGCTTTAGCAAAAGCCCAGCAATTATTACTTGACCCTCAGGAGAGGGATTATATTCTGAACCAGGTTAATGCAGCAAAAGAAGA
GCTGATAGCACAGTGGAAGAAGCAGCTTAAGAAAGATACTGCTAGTAAATTGAAATCATTAGTTACTGAGGGAAAGTTCGACCAAGAGCATGAGC
AATCAGAAGAATTCCAGCATAAGCTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302707] SGN-U569691 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118390 [Download] [View] Facility Assigned ID: TRYAA90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0155 Quality Trim Threshold: 14.5