EST details — SGN-E302718

Search information 
Request: 302718Match: SGN-E302718
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97138Clone name: cLEY-1-A9
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192638 [TUS-66-C4] Trace: SGN-T344892 EST: SGN-E544017 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192638 [TUS-66-C4] Trace: SGN-T344893 EST: SGN-E544018 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302718Length: 490 bp (854 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E302718 [] (trimmed) GAGCAATATCAAGAGCCTTTGGTGATTACTACATAAAGGACTTTGGCCTTATTTCTGAACCAGAATTGACGTCCAGAAAAATAACACATAGAGAT
CAGTTTGCCATCTTGGCAACAGATGGGGTTTGGGATGTGATGTCAAATGATGAAGCAGTGGAGATAGTATCTTCAACAGGAGAAAGGGAAGATGC
AGCTAAGAGGCTGGTGGAAAGTGCTATTTGTGCGTGGAAACACAAACGAAGAGGAGCTCCTATGGATGATATCTCAGCAATATGCCTCTTCTTTC
ATAACATTCCTCTTTCAAAACAACAAGCTAAGAGTGTCTAAAATTCAACAAGCTTACATGAACTACTAGCTGACTTTCAATTGCTGTTTTTTCCC
TATTTTTTTCAGTACTTAATGGTTTGTACATAAGTTCATACATACATATATAGGCTCTTCATGTTTGCTACTATTTTTCTATCAGTCATTGAAAT
GGAAAATCTTGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302718] SGN-U574025 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118401 [Download] [View] Facility Assigned ID: TRYAA05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0038 Quality Trim Threshold: 12.5