EST details — SGN-E302751

Search information 
Request: 302751Match: SGN-E302751
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97171Clone name: cLEY-1-I7
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97171 [cLEY-1-I7] Trace: SGN-T118433 EST: SGN-E302750 Direction: 5' Facility: TIGR
Clone: SGN-C192647 [TUS-66-C13] Trace: SGN-T344908 EST: SGN-E544033 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192647 [TUS-66-C13] Trace: SGN-T344909 EST: SGN-E544034 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302751Length: 201 bp (837 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E302751 [] (trimmed) GACTTCAGAATATTACAACAGTACTGACTAAAGTAGAAACATAACTTCAAACATTTGGTTCAAAGGGCTCTGCAGAAGAGATCTACAACCAACAA
AATTGAGTTAAGAGAAGTATAAACCACATTTCTAATGAGGCAAAAAATTCCTAATGTGTTAGTCATTATTTGCCGCGGACCTGCCAAGATTTACG
CATCCCCTAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302751] SGN-U562800 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118434 [Download] [View] Facility Assigned ID: TRYAA52TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5