EST details — SGN-E302989

Search information 
Request: 302989Match: SGN-E302989
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91265Clone name: cLEW-26-K15
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192004 [TUS-64-H18] Trace: SGN-T343804 EST: SGN-E542929 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302989Length: 540 bp (1458 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E302989 [] (trimmed) GAATTGGCTGAAGCTTTCTGAGTTCGTTCTATCCAAAAAATGGGAATCAAGGGTTTAATGAAGCTGTTGGCTGACAATGCTCCAAGTGGAATGAA
GGAGCAGAAGTTCGAGAGCTATTTCGGCCGTAAAATAGCCATCGACGCTAGTATGAGCATTTATCAGTTCCTGATTGTAGTAGGACGAAGCGGTA
CGGAAATGCTCACTAACGAAGCTGGGGAAACTACTAGTCATTTGGTCGGGATGTTTTCGCGGACGATTAGGCTTTTGGAAGCTGGAATCAAGCCA
GTTTATGTTTTTGATGGCAAGCCCCCTGATTTGAAGAAACAAGAACTTGCAAAACGTTACTCTAGAAGGGAAGATGCCACAGATGACTTGGCTAA
GGCTACAGAGAGTGGCAACAAGGAGGATATTGAGAAATTCAGCAAGAGAACAGTAAAGGTTACATCACAACACAATGATGACTGCAAAAAACTTC
TCAGACTAATGGGGGTACCTGCTGTTGAGGCTCCTTCTGAAGCAGAGGCTCAGTGTGCTGCACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302989] SGN-U575786 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114821 [Download] [View] Facility Assigned ID: TRDDW68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5