EST details — SGN-E303377

Search information 
Request: 303377Match: SGN-E303377
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94072Clone name: cLEX-2-F23
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192093 [TUS-64-L11] Trace: SGN-T343956 EST: SGN-E543081 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192093 [TUS-64-L11] Trace: SGN-T343957 EST: SGN-E543082 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303377Length: 383 bp (502 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E303377 [] (trimmed) GATTTTTGAATATTACAACTTTACTTTCTCCATATAAATCCTTACCCAACCATTCTTCCATTTCCATATCCAAATCCAAAAAAACTCTCTTTTTT
TATTCCATACCAACAACAACATAGATATCGATTATCGATCATCGAATCAAAGTATTTTTATTTAACTTACAACGATAAATGAAGATTGGATGGGA
ATCACTTGTTCCTAGCTGTATTAAATCACATGAAAATTCGAAAAAAAATCCAAAAATGGTAAAAGTGTCCGTTACAAAACAAATCTCTTTTCATG
GGATACCTGTATCGGATCTTAGTTCATCCACCATATCCTCAGATCTTTCTATCTCCCTTGCTGGTTCAAATATTCATGCCTTTACACAACAAGAA
CTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303377] SGN-U583550 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115465 [Download] [View] Facility Assigned ID: TRXAG36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.910 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5